Transcript: Human NM_020347.4

Homo sapiens leucine zipper transcription factor like 1 (LZTFL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
LZTFL1 (54585)
Length:
4026
CDS:
129..1028

Additional Resources:

NCBI RefSeq record:
NM_020347.4
NBCI Gene record:
LZTFL1 (54585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015139 GCAGCTTATCGAAACATGAAA pLKO.1 933 CDS 100% 5.625 7.875 N LZTFL1 n/a
2 TRCN0000015138 GCCTATACCAATGTGTTACTT pLKO.1 357 CDS 100% 5.625 7.875 N LZTFL1 n/a
3 TRCN0000015140 GCCCAAGACTTAAGTAACTTA pLKO.1 741 CDS 100% 5.625 4.500 N LZTFL1 n/a
4 TRCN0000413801 TTAGAACTAGAGTTCCTATTT pLKO_005 1156 3UTR 100% 13.200 9.240 N LZTFL1 n/a
5 TRCN0000431772 TGGAACAGCAGAACTCCTAAA pLKO_005 560 CDS 100% 10.800 7.560 N LZTFL1 n/a
6 TRCN0000015141 CCATTGAAATACAGGCTACAA pLKO.1 637 CDS 100% 4.950 3.465 N LZTFL1 n/a
7 TRCN0000015142 TGCTCGTTCAAAGAGAGGCTT pLKO.1 188 CDS 100% 2.640 1.848 N LZTFL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03440 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03440 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465884 CCGAACCATAATTAGGCGGTCATG pLX_317 45.4% 100% 100% V5 n/a
4 ccsbBroadEn_08395 pDONR223 100% 99.6% 98.9% None 323G>A;454A>G;752A>G n/a
5 ccsbBroad304_08395 pLX_304 0% 99.6% 98.9% V5 323G>A;454A>G;752A>G n/a
6 TRCN0000469753 GGATATGCGTCTAGCGCAAAACCG pLX_317 50.1% 99.6% 98.9% V5 323G>A;454A>G;752A>G n/a
Download CSV