Construct: ORF TRCN0000469753
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000069.1_s317c1
- Derived from:
- ccsbBroadEn_08395
- DNA Barcode:
- GGATATGCGTCTAGCGCAAAACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LZTFL1 (54585)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469753
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54585 | LZTFL1 | leucine zipper transcriptio... | NM_020347.4 | 99.6% | 98.9% | 323G>A;454A>G;752A>G |
2 | human | 54585 | LZTFL1 | leucine zipper transcriptio... | NM_001276378.1 | 93.9% | 93.3% | (many diffs) |
3 | human | 54585 | LZTFL1 | leucine zipper transcriptio... | XM_011533838.2 | 93.9% | 93.3% | (many diffs) |
4 | human | 54585 | LZTFL1 | leucine zipper transcriptio... | XM_017006645.2 | 87.3% | 82.9% | (many diffs) |
5 | human | 54585 | LZTFL1 | leucine zipper transcriptio... | XM_006713207.3 | 86.3% | 85.6% | (many diffs) |
6 | human | 54585 | LZTFL1 | leucine zipper transcriptio... | NM_001276379.1 | 75.2% | 69.7% | (many diffs) |
7 | human | 54585 | LZTFL1 | leucine zipper transcriptio... | NR_075080.2 | 20.9% | (many diffs) | |
8 | mouse | 93730 | Lztfl1 | leucine zipper transcriptio... | NM_033322.2 | 86.6% | 89.9% | (many diffs) |
9 | mouse | 93730 | Lztfl1 | leucine zipper transcriptio... | XM_006512403.3 | 81.2% | 84.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 963
- ORF length:
- 897
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agagttgggc ctaaatgagc accatcaaaa tgaagttatt aattatatgc 121 gttttgctcg ttcaaagaga ggcttgagac tcaaaactgt agattcctgc ttccaagacc 181 tcaaggagag caggctggtg gaggacacct tcaccataga tgaagtctct gaagtcctca 241 atggattaca agctgtggtt catagtgagg tggaatctga gctcatcaac actgcctata 301 ccaatgtgtt acttctgcga cagctgtttg cacaagctga gaagtggtat cttaagctac 361 agacagacat ctctgaactt gaaaaccaag aattattaga acaagttgca gaatttgaaa 421 aagcagagat tacatcttca aacaaaaagc ccatcttaga tgtcacaaag ccaaaacttg 481 ctccacttaa tgaaggtgga acagcagaac tccTAAACGA GGAAATTTTA AGACTTCAAG 541 AAGAGAATGA GAAATTGAAG TCAAGGTTGA AGACCATTGA AATACAGGCT ACAAATGCAC 601 TGGATGAAAA GTCAAAACTA GAAAAAGCAC TGCAAGATTT ACAGCTTGAT CAAGGAAATC 661 AAAAGGATTT TATAAAGGCC CAAGACTTAA GTAACTTAGA AAACACTGTC GCTGCCTTAA 721 AGAGTGAGTT TCAGAAGACA CTTAATGACA AGACAGAAAA CCAGAAGTCA CTGGAGGAGA 781 ATCTGGCGAC AGCCAAGCAC GATCTACTCA GGGTTCGGGA GCAGCTGCAC ATGGCTGAAA 841 AGGAATTAGA AAAGAAATTT CAGCAAACAG CAGCTTATCG AAACATGAAA GAGATTCTTA 901 CCAAGAAGAA TGACCAAATC AAAGATCTGA GGAAAAGACT GGCACAATAT GAACCTGAAG 961 ATTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1021 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1081 GGCTTTATAT ATCTTGTGGA AAGGACGAGG ATATGCGTCT AGCGCAAAAC CGACGCGTTA 1141 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt