Transcript: Human NM_020353.3

Homo sapiens phospholipid scramblase 4 (PLSCR4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PLSCR4 (57088)
Length:
3233
CDS:
168..1157

Additional Resources:

NCBI RefSeq record:
NM_020353.3
NBCI Gene record:
PLSCR4 (57088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423550 ATATCCAACATCGGCAGTATT pLKO_005 972 CDS 100% 13.200 18.480 N PLSCR4 n/a
2 TRCN0000438444 CCGGTATCAGCCTGGCAAATA pLKO_005 410 CDS 100% 13.200 18.480 N PLSCR4 n/a
3 TRCN0000427964 GAATGCCTATCGGACACTAAG pLKO_005 662 CDS 100% 10.800 15.120 N PLSCR4 n/a
4 TRCN0000430816 GAGTATCTCTCTAGTAGAATA pLKO_005 1342 3UTR 100% 13.200 9.240 N PLSCR4 n/a
5 TRCN0000053422 CCTCCTGGTCTGGAATACTTA pLKO.1 495 CDS 100% 5.625 3.938 N PLSCR4 n/a
6 TRCN0000053420 CGGAAGTGGAATGGTTTGTTA pLKO.1 996 CDS 100% 5.625 3.938 N PLSCR4 n/a
7 TRCN0000053421 CCTATGCCAAATCAGTCTGTT pLKO.1 432 CDS 100% 4.950 3.465 N PLSCR4 n/a
8 TRCN0000053419 GCTGTGGTTCAGATTCTGTTT pLKO.1 928 CDS 100% 4.950 3.465 N PLSCR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03777 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03777 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466205 TTTTTTTAATATGCCATAACCCTT pLX_317 33.3% 100% 100% V5 n/a
Download CSV