Transcript: Human NM_020416.4

Homo sapiens protein phosphatase 2 regulatory subunit Bgamma (PPP2R2C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PPP2R2C (5522)
Length:
4450
CDS:
386..1729

Additional Resources:

NCBI RefSeq record:
NM_020416.4
NBCI Gene record:
PPP2R2C (5522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006867 CCGCTCATTCTTCTCGGAAAT pLKO.1 1204 CDS 100% 10.800 15.120 N PPP2R2C n/a
2 TRCN0000352690 CCGCTCATTCTTCTCGGAAAT pLKO_005 1204 CDS 100% 10.800 15.120 N PPP2R2C n/a
3 TRCN0000006868 GCCGGAGTTTGACTATCTCAA pLKO.1 616 CDS 100% 4.950 6.930 N PPP2R2C n/a
4 TRCN0000342442 GCCGGAGTTTGACTATCTCAA pLKO_005 616 CDS 100% 4.950 6.930 N PPP2R2C n/a
5 TRCN0000006869 CTGTACGAGAACGACTGCATT pLKO.1 1379 CDS 100% 4.950 3.465 N PPP2R2C n/a
6 TRCN0000342496 CTGTACGAGAACGACTGCATT pLKO_005 1379 CDS 100% 4.950 3.465 N PPP2R2C n/a
7 TRCN0000039561 TTTCCTAGGCCAGAATTGTGT pLKO.1 1898 3UTR 100% 3.000 2.100 N PPP2R2C n/a
8 TRCN0000006866 GCTGACATCATCTCTACCGTT pLKO.1 455 CDS 100% 2.640 1.848 N PPP2R2C n/a
9 TRCN0000342441 GCTGACATCATCTCTACCGTT pLKO_005 455 CDS 100% 2.640 1.848 N PPP2R2C n/a
10 TRCN0000006865 CCTTGTAAAGAGGTTCGAGAA pLKO.1 3666 3UTR 100% 4.050 2.430 N PPP2R2C n/a
11 TRCN0000039560 TATCTCAAGAGCCTGGAGATA pLKO.1 629 CDS 100% 0.495 0.297 N PPP2R2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11051 pDONR223 100% 95.8% 95.7% None (many diffs) n/a
2 ccsbBroad304_11051 pLX_304 0% 95.8% 95.7% V5 (many diffs) n/a
3 TRCN0000480089 TCTGATCCGACTCTATAAGCTTCA pLX_317 30.3% 95.8% 95.7% V5 (many diffs) n/a
Download CSV