Transcript: Human NM_020433.4

Homo sapiens junctophilin 2 (JPH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
JPH2 (57158)
Length:
4802
CDS:
874..2964

Additional Resources:

NCBI RefSeq record:
NM_020433.4
NBCI Gene record:
JPH2 (57158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020433.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157004 GTCCAACATTGCTCGCACTTT pLKO.1 2106 CDS 100% 4.950 6.930 N JPH2 n/a
2 TRCN0000157005 GCTTCACACTTGCCGTTTCAA pLKO.1 4409 3UTR 100% 5.625 4.500 N JPH2 n/a
3 TRCN0000153385 GCTTTCCCATTTCCCTTCAAT pLKO.1 4367 3UTR 100% 5.625 3.938 N JPH2 n/a
4 TRCN0000157363 CATGGTGATCCTGCTGAACAT pLKO.1 2907 CDS 100% 4.950 3.465 N JPH2 n/a
5 TRCN0000154086 CCTTTGGCTTACTTGGTAGAA pLKO.1 4049 3UTR 100% 4.950 3.465 N JPH2 n/a
6 TRCN0000153315 GAAACACCTTTGAGGGATACT pLKO.1 1043 CDS 100% 4.950 3.465 N JPH2 n/a
7 TRCN0000157868 CGGAAACACCTTTGAGGGATA pLKO.1 1041 CDS 100% 4.050 2.835 N JPH2 n/a
8 TRCN0000156385 CAACACCATCCTCATCTGCAT pLKO.1 2889 CDS 100% 2.640 1.848 N JPH2 n/a
9 TRCN0000153036 GCTGCTTGTCAAGAAGCATTT pLKO.1 3965 3UTR 100% 1.080 0.756 N JPH2 n/a
10 TRCN0000157736 CATCCTCATCTGCATGGTGAT pLKO.1 2895 CDS 100% 4.050 2.430 N JPH2 n/a
11 TRCN0000157328 CCCTTCATTTCTGTGGACCTT pLKO.1 4274 3UTR 100% 2.640 1.584 N JPH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020433.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.