Transcript: Mouse NM_020486.2

Mus musculus basal cell adhesion molecule (Bcam), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bcam (57278)
Length:
2407
CDS:
63..1931

Additional Resources:

NCBI RefSeq record:
NM_020486.2
NBCI Gene record:
Bcam (57278)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113601 CTGAGCATTACGTGCTGGAAT pLKO.1 220 CDS 100% 4.950 6.930 N Bcam n/a
2 TRCN0000325701 CTGAGCATTACGTGCTGGAAT pLKO_005 220 CDS 100% 4.950 6.930 N Bcam n/a
3 TRCN0000113600 GCCTTCCTCCAGGGAATGTAA pLKO.1 2142 3UTR 100% 5.625 3.938 N Bcam n/a
4 TRCN0000325708 GCCTTCCTCCAGGGAATGTAA pLKO_005 2142 3UTR 100% 5.625 3.938 N Bcam n/a
5 TRCN0000113602 GCTGCTTTCTATTGCATGAGA pLKO.1 1740 CDS 100% 3.000 2.100 N Bcam n/a
6 TRCN0000325702 GCTGCTTTCTATTGCATGAGA pLKO_005 1740 CDS 100% 3.000 2.100 N Bcam n/a
7 TRCN0000113603 GTGCAACTTGTCAAGAAGCTA pLKO.1 1083 CDS 100% 3.000 2.100 N Bcam n/a
8 TRCN0000325700 GTGCAACTTGTCAAGAAGCTA pLKO_005 1083 CDS 100% 3.000 2.100 N Bcam n/a
9 TRCN0000113604 GTCCTGTGAAGCGTCTAACAT pLKO.1 1604 CDS 100% 5.625 3.375 N Bcam n/a
10 TRCN0000325768 GTCCTGTGAAGCGTCTAACAT pLKO_005 1604 CDS 100% 5.625 3.375 N Bcam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.