Transcript: Human NM_020530.6

Homo sapiens oncostatin M (OSM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
OSM (5008)
Length:
1865
CDS:
53..811

Additional Resources:

NCBI RefSeq record:
NM_020530.6
NBCI Gene record:
OSM (5008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020530.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058985 CGGGCTCAGGAACAACATCTA pLKO.1 484 CDS 100% 4.950 6.930 N OSM n/a
2 TRCN0000058986 CCATCGCTTCATGCACTCAGT pLKO.1 646 CDS 100% 2.640 2.112 N OSM n/a
3 TRCN0000378941 ACTTCCTCCTTTCCGTGTTTC pLKO_005 1198 3UTR 100% 10.800 7.560 N OSM n/a
4 TRCN0000373165 GGACCGACTTTCCATTGATTC pLKO_005 1066 3UTR 100% 10.800 7.560 N OSM n/a
5 TRCN0000378867 TGGTCCTTGCACTCCTGTTTC pLKO_005 90 CDS 100% 10.800 7.560 N OSM n/a
6 TRCN0000378866 CTATAGGCAGCTGCTCGAAAG pLKO_005 132 CDS 100% 6.000 4.200 N OSM n/a
7 TRCN0000058983 GCCTGGATGTTCCTAAACTGA pLKO.1 243 CDS 100% 3.000 2.100 N OSM n/a
8 TRCN0000058987 CCTGCACAGACTGGCCGACTT pLKO.1 370 CDS 100% 0.000 0.000 N OSM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020530.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01126 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01126 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466753 TGTACGGGGTCCCTGCGTGTATGT pLX_317 51.4% 100% 100% V5 n/a
Download CSV