Transcript: Human NM_020549.4

Homo sapiens choline O-acetyltransferase (CHAT), transcript variant M, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CHAT (1103)
Length:
2458
CDS:
154..2400

Additional Resources:

NCBI RefSeq record:
NM_020549.4
NBCI Gene record:
CHAT (1103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020549.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437944 ACGAGCGTTTGCCTCCAATTG pLKO_005 1184 CDS 100% 10.800 8.640 N CHAT n/a
2 TRCN0000035297 GCTGAATGACATGTATCTCAA pLKO.1 747 CDS 100% 4.950 3.960 N CHAT n/a
3 TRCN0000035298 CCTTGACTTCATTGTCTATAA pLKO.1 1677 CDS 100% 13.200 9.240 N CHAT n/a
4 TRCN0000035295 CCTTTGCATGAAGCAATACTA pLKO.1 954 CDS 100% 5.625 3.938 N CHAT n/a
5 TRCN0000035294 CCCGAGATGTTCATGGATGAA pLKO.1 2068 CDS 100% 4.950 3.465 N CHAT n/a
6 TRCN0000110649 TCAGTTGAGAAAGATAGTCAA pLKO.1 1146 CDS 100% 4.950 3.465 N Chat n/a
7 TRCN0000035296 GCTGTGGAAGAAAGCCTCATT pLKO.1 2281 CDS 100% 4.950 2.970 N CHAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020549.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15383 pDONR223 0% 84.1% 84.2% None 1_354del;1641T>C n/a
2 ccsbBroad304_15383 pLX_304 0% 84.1% 84.2% V5 1_354del;1641T>C n/a
3 TRCN0000479910 TTACACGATAACCCCGACATACGC pLX_317 18.7% 84.1% 84.2% V5 1_354del;1641T>C n/a
Download CSV