Transcript: Human NM_020648.6

Homo sapiens twisted gastrulation BMP signaling modulator 1 (TWSG1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TWSG1 (57045)
Length:
3750
CDS:
186..857

Additional Resources:

NCBI RefSeq record:
NM_020648.6
NBCI Gene record:
TWSG1 (57045)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020648.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122458 GCGCCTTATTCCAGTGACAAA pLKO.1 654 CDS 100% 4.950 6.930 N TWSG1 n/a
2 TRCN0000144589 GAATCACTGAGCTGTAACAAA pLKO.1 249 CDS 100% 5.625 4.500 N TWSG1 n/a
3 TRCN0000145037 GACTGTGTTGGTATGTGTAAT pLKO.1 399 CDS 100% 13.200 9.240 N TWSG1 n/a
4 TRCN0000143713 GATGACTGCATGTCCATACAT pLKO.1 702 CDS 100% 5.625 3.938 N TWSG1 n/a
5 TRCN0000143264 GCATCTGTAGAGCTGAAAGTA pLKO.1 2596 3UTR 100% 5.625 3.938 N TWSG1 n/a
6 TRCN0000143526 GATGTGAGCAAATGCCTCATT pLKO.1 285 CDS 100% 4.950 3.465 N TWSG1 n/a
7 TRCN0000144633 GCAGAAGAACTTTCACATCAT pLKO.1 555 CDS 100% 4.950 3.465 N TWSG1 n/a
8 TRCN0000143265 GCATGTCCATACATCAGTGTA pLKO.1 709 CDS 100% 4.950 3.465 N TWSG1 n/a
9 TRCN0000143868 GCCTTATTCCAGTGACAAAGA pLKO.1 656 CDS 100% 4.950 3.465 N TWSG1 n/a
10 TRCN0000145279 GCTGAAAGTATTCTGGAACTT pLKO.1 2607 3UTR 100% 4.950 3.465 N TWSG1 n/a
11 TRCN0000144936 GTTGCAGAAGAACTTTCACAT pLKO.1 552 CDS 100% 4.950 3.465 N TWSG1 n/a
12 TRCN0000144982 GCTTTGAAAGTGTTAGCAGAA pLKO.1 1195 3UTR 100% 4.050 2.835 N TWSG1 n/a
13 TRCN0000201700 GTAACAAAGCACTCTGTGCCA pLKO.1 262 CDS 100% 0.660 0.396 N Twsg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020648.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08691 pDONR223 100% 99.8% 99.5% None 21T>N n/a
2 ccsbBroad304_08691 pLX_304 0% 99.8% 99.5% V5 21T>N n/a
Download CSV