Transcript: Human NM_020724.2

Homo sapiens ring finger protein 150 (RNF150), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RNF150 (57484)
Length:
10432
CDS:
662..1978

Additional Resources:

NCBI RefSeq record:
NM_020724.2
NBCI Gene record:
RNF150 (57484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086844 CTGCACGTACAGGGATAAGAT pLKO.1 1036 CDS 100% 5.625 7.875 N Rnf150 n/a
2 TRCN0000118553 CCATAATGATTCCTGAGCCAA pLKO.1 1164 CDS 100% 2.640 3.696 N RNF150 n/a
3 TRCN0000118552 CCACTCTCTATGTGTGGGAAA pLKO.1 3784 3UTR 100% 4.050 3.240 N RNF150 n/a
4 TRCN0000118554 CCAGAGGTTTCGATATGCAAA pLKO.1 1357 CDS 100% 4.950 3.465 N RNF150 n/a
5 TRCN0000118555 CTGTCCCATGTGCAAGATGAA pLKO.1 1603 CDS 100% 4.950 3.465 N RNF150 n/a
6 TRCN0000118556 CAAACTCCAGATCAGGACCAT pLKO.1 1432 CDS 100% 2.640 1.584 N RNF150 n/a
7 TRCN0000086846 GCCTTCGTGAACATCACCTAT pLKO.1 785 CDS 100% 4.950 3.465 N Rnf150 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020724.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12349 pDONR223 100% 71.5% 70.7% None (many diffs) n/a
2 ccsbBroad304_12349 pLX_304 0% 71.5% 70.7% V5 (many diffs) n/a
3 TRCN0000473506 ACCCAGGCTATCAGGATCTATATA pLX_317 48.1% 71.5% 70.7% V5 (many diffs) n/a
Download CSV