Transcript: Human NM_020728.3

Homo sapiens extended synaptotagmin 2 (ESYT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ESYT2 (57488)
Length:
5839
CDS:
92..2629

Additional Resources:

NCBI RefSeq record:
NM_020728.3
NBCI Gene record:
ESYT2 (57488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138050 CCAGGAGAGCAAGATTCGATA pLKO.1 1573 CDS 100% 4.950 6.930 N ESYT2 n/a
2 TRCN0000135582 GTGTATGAACATCCTGGACAA pLKO.1 1199 CDS 100% 4.050 5.670 N ESYT2 n/a
3 TRCN0000264260 AGGAAATTGTGAGATTGATTT pLKO_005 682 CDS 100% 13.200 9.240 N Esyt2 n/a
4 TRCN0000136269 GCGACTGTAAAGCCTCTTTAT pLKO.1 4379 3UTR 100% 13.200 9.240 N ESYT2 n/a
5 TRCN0000135015 CCAGTGTTTGATCAAAGCTTT pLKO.1 2411 CDS 100% 4.950 3.465 N ESYT2 n/a
6 TRCN0000138341 CCTGTACCAAAGGGTGTTCTA pLKO.1 1004 CDS 100% 4.950 3.465 N ESYT2 n/a
7 TRCN0000137576 CCTGTTGTCCAGATGTCAGTT pLKO.1 1541 CDS 100% 4.950 3.465 N ESYT2 n/a
8 TRCN0000138062 GCTCGCAGAGAAACAAGCTTA pLKO.1 2253 CDS 100% 4.950 3.465 N ESYT2 n/a
9 TRCN0000135531 CTGAAAGAGCAGAATGGCTAA pLKO.1 438 CDS 100% 4.050 2.835 N ESYT2 n/a
10 TRCN0000135883 GCCTTAAAGTAGGAAGGTGTT pLKO.1 5180 3UTR 100% 4.050 2.835 N ESYT2 n/a
11 TRCN0000135530 CTCCTTGGCAAAGTATTGGTT pLKO.1 2522 CDS 100% 3.000 2.100 N ESYT2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5249 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5250 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5420 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.