Transcript: Human NM_020737.3

Homo sapiens leucine rich repeat and fibronectin type III domain containing 2 (LRFN2), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
LRFN2 (57497)
Length:
3164
CDS:
443..2812

Additional Resources:

NCBI RefSeq record:
NM_020737.3
NBCI Gene record:
LRFN2 (57497)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419939 GGACCGCTGTCTATGACAATG pLKO_005 1446 CDS 100% 10.800 15.120 N LRFN2 n/a
2 TRCN0000154610 GCAGCACCTTATCGTGAACAA pLKO.1 820 CDS 100% 4.950 6.930 N LRFN2 n/a
3 TRCN0000414927 GAGTTTCCATGGTGATGTTTA pLKO_005 2888 3UTR 100% 13.200 9.240 N LRFN2 n/a
4 TRCN0000431133 TGACGATGAGGTACTGATTTA pLKO_005 1819 CDS 100% 13.200 9.240 N LRFN2 n/a
5 TRCN0000153075 GTAACCCACTTCACTGCAATT pLKO.1 1164 CDS 100% 10.800 7.560 N LRFN2 n/a
6 TRCN0000154313 CAGTTTCGTCTCCCTGTCAAT pLKO.1 2919 3UTR 100% 4.950 3.465 N LRFN2 n/a
7 TRCN0000152563 GAATCTCACTGGCAAGTGTTT pLKO.1 2864 3UTR 100% 4.950 3.465 N LRFN2 n/a
8 TRCN0000156050 CCTCAAGAGTCAGAGAAAGGA pLKO.1 2434 CDS 100% 3.000 2.100 N LRFN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03826 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03826 pLX_304 0% 100% 100% V5 n/a
Download CSV