Transcript: Human NM_020739.4

Homo sapiens cell cycle progression 1 (CCPG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CCPG1 (9236)
Length:
6698
CDS:
149..2422

Additional Resources:

NCBI RefSeq record:
NM_020739.4
NBCI Gene record:
CCPG1 (9236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243126 GCTGGTATCTAGTCCTATAAT pLKO_005 3114 3UTR 100% 15.000 21.000 N CCPG1 n/a
2 TRCN0000183068 CCACCTAAGTTAGAAGAAATT pLKO.1 479 CDS 100% 13.200 6.600 Y CCPG1 n/a
3 TRCN0000243129 GACAAGTACTGAATTAGTTAA pLKO_005 1174 CDS 100% 13.200 6.600 Y CCPG1 n/a
4 TRCN0000243125 TAGATAATGATGGAGTATTTG pLKO_005 2295 CDS 100% 13.200 6.600 Y CCPG1 n/a
5 TRCN0000243127 TGAATGATATGAAGGATTATC pLKO_005 912 CDS 100% 13.200 6.600 Y CCPG1 n/a
6 TRCN0000243128 TACCCGAAGACAGTATCTATA pLKO_005 417 CDS 100% 0.000 0.000 Y CCPG1 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4311 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4311 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11352 pDONR223 100% 80.5% 79.7% None (many diffs) n/a
2 ccsbBroad304_11352 pLX_304 0% 80.5% 79.7% V5 (many diffs) n/a
3 TRCN0000479237 GCGTTTACATTCCGTCAGGGGGGG pLX_317 23.5% 80.5% 79.7% V5 (many diffs) n/a
Download CSV