Transcript: Human NM_020760.4

Homo sapiens HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 (HECW2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
HECW2 (57520)
Length:
12479
CDS:
556..5274

Additional Resources:

NCBI RefSeq record:
NM_020760.4
NBCI Gene record:
HECW2 (57520)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004790 CCAGGGAAGTTAAAGTTAATT pLKO.1 4192 CDS 100% 15.000 10.500 N HECW2 n/a
2 TRCN0000004791 GCACAATACTTGGAGTCAATT pLKO.1 1562 CDS 100% 13.200 9.240 N HECW2 n/a
3 TRCN0000004793 CCCTTATCTTAAGATGTCAAT pLKO.1 1173 CDS 100% 4.950 3.465 N HECW2 n/a
4 TRCN0000004789 GCCCAAACATTTCTTTGAGAT pLKO.1 6921 3UTR 100% 4.950 3.465 N HECW2 n/a
5 TRCN0000086876 CCTCATTATCTTCTGGGACAT pLKO.1 780 CDS 100% 4.050 2.835 N Hecw2 n/a
6 TRCN0000086874 GTTCTTCAATCCTGACCCTTA pLKO.1 1158 CDS 100% 4.050 2.835 N Hecw2 n/a
7 TRCN0000004792 GCTTACAATGACAAGATTGTT pLKO.1 3793 CDS 100% 0.563 0.394 N HECW2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.