Transcript: Human NM_020805.3

Homo sapiens kelch like family member 14 (KLHL14), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KLHL14 (57565)
Length:
4271
CDS:
401..2287

Additional Resources:

NCBI RefSeq record:
NM_020805.3
NBCI Gene record:
KLHL14 (57565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129848 CCTCGATTTAATAGCTGGATT pLKO.1 1595 CDS 100% 4.950 6.930 N KLHL14 n/a
2 TRCN0000130538 GCCACTTGATTCTGTACTCTT pLKO.1 2738 3UTR 100% 4.950 6.930 N KLHL14 n/a
3 TRCN0000129068 GAAACGAATGAATGGCGCTAT pLKO.1 1739 CDS 100% 4.050 5.670 N KLHL14 n/a
4 TRCN0000129002 GCTTGATGACAGCATTTACCT pLKO.1 2101 CDS 100% 3.000 4.200 N KLHL14 n/a
5 TRCN0000129714 CCAGCAATTTGGTTCAGTATT pLKO.1 1413 CDS 100% 13.200 10.560 N KLHL14 n/a
6 TRCN0000129109 CGATGCCGTTTCTACAGTAAA pLKO.1 3756 3UTR 100% 13.200 9.240 N KLHL14 n/a
7 TRCN0000130739 GCCCTCTTGTGTACCATACAA pLKO.1 2260 CDS 100% 5.625 3.938 N KLHL14 n/a
8 TRCN0000130211 CCAGAGCTTGAACAACAACTT pLKO.1 3565 3UTR 100% 4.950 3.465 N KLHL14 n/a
9 TRCN0000130437 GCTATTGTCCAGAGAAAGGAA pLKO.1 2172 CDS 100% 3.000 2.100 N KLHL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12365 pDONR223 100% 59.7% 57.5% None (many diffs) n/a
2 ccsbBroad304_12365 pLX_304 0% 59.7% 57.5% V5 (many diffs) n/a
3 TRCN0000465767 CTTCAACTGATCTACACCTCTTAT pLX_317 32.5% 59.7% 57.5% V5 (many diffs) n/a
Download CSV