Transcript: Human NM_020846.2

Homo sapiens SLAIN motif family member 2 (SLAIN2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLAIN2 (57606)
Length:
6081
CDS:
212..1957

Additional Resources:

NCBI RefSeq record:
NM_020846.2
NBCI Gene record:
SLAIN2 (57606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253841 TATACTCATCGGCCTTATTTA pLKO_005 5730 3UTR 100% 15.000 21.000 N SLAIN2 n/a
2 TRCN0000253839 ATCGGTTAGTCCATTAGTTTG pLKO_005 643 CDS 100% 10.800 15.120 N SLAIN2 n/a
3 TRCN0000253838 TGCGACCTCCTATAGTCAAAC pLKO_005 870 CDS 100% 10.800 15.120 N SLAIN2 n/a
4 TRCN0000253837 TATCCACAAACTTGATCAAAC pLKO_005 721 CDS 100% 10.800 7.560 N SLAIN2 n/a
5 TRCN0000253840 TTTCACCATCACCACGCAATT pLKO_005 1236 CDS 100% 10.800 7.560 N SLAIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03835 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03835 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477057 CTAGTAGACCTTGTTCCTCTTGGT pLX_317 20.8% 100% 100% V5 n/a
Download CSV