Transcript: Human NM_020954.4

Homo sapiens ring finger protein 213 (RNF213), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
RNF213 (57674)
Length:
5334
CDS:
160..3351

Additional Resources:

NCBI RefSeq record:
NM_020954.4
NBCI Gene record:
RNF213 (57674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019041 CCTTACAAGTACGTCATTTAT pLKO.1 1504 CDS 100% 15.000 21.000 N RNF213 n/a
2 TRCN0000019039 GCAGAATGATTAGACTTCTAT pLKO.1 2786 CDS 100% 5.625 3.938 N RNF213 n/a
3 TRCN0000019040 GCTCAGACAGTTGGCAAGAAA pLKO.1 356 CDS 100% 5.625 3.938 N RNF213 n/a
4 TRCN0000019043 CGATTTGCAGTACAGGGAGAA pLKO.1 1890 CDS 100% 4.050 2.835 N RNF213 n/a
5 TRCN0000019042 CGCTAACTCAGAGATTGGGAA pLKO.1 3285 CDS 100% 2.640 1.848 N RNF213 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08756 pDONR223 100% 99.8% 99.8% None (many diffs) n/a
2 ccsbBroad304_08756 pLX_304 0% 99.8% 99.8% V5 (many diffs) n/a
3 TRCN0000478695 GAGCTGGGGACCGAGGGTTTTGCA pLX_317 11.1% 99.8% 99.8% V5 (many diffs) n/a
Download CSV