Transcript: Human NM_020967.3

Homo sapiens nuclear receptor coactivator 5 (NCOA5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NCOA5 (57727)
Length:
3224
CDS:
176..1915

Additional Resources:

NCBI RefSeq record:
NM_020967.3
NBCI Gene record:
NCOA5 (57727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020967.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415614 GGATCTTACCAGAGGCATTAC pLKO_005 1892 CDS 100% 10.800 15.120 N NCOA5 n/a
2 TRCN0000417819 TAGAGACTTTCGTGATCTAAG pLKO_005 436 CDS 100% 10.800 15.120 N NCOA5 n/a
3 TRCN0000021948 CGGCGTAGAGAAGAGCTTTAT pLKO.1 698 CDS 100% 13.200 9.240 N NCOA5 n/a
4 TRCN0000423249 GCTTATTCCTTACAAAGTTTA pLKO_005 2077 3UTR 100% 13.200 9.240 N NCOA5 n/a
5 TRCN0000021946 GCAGGAGAAAGGATGACTCTT pLKO.1 585 CDS 100% 4.950 3.465 N NCOA5 n/a
6 TRCN0000021945 GCCCGTTGATTGTTCTGTGAT pLKO.1 763 CDS 100% 4.950 3.465 N NCOA5 n/a
7 TRCN0000021947 CTCAACAAAGATCACAGGCTT pLKO.1 1593 CDS 100% 2.640 1.848 N NCOA5 n/a
8 TRCN0000021944 CCACAGACATAGTAGAGATTT pLKO.1 361 CDS 100% 13.200 7.920 N NCOA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020967.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12401 pDONR223 100% 52.3% 46.1% None (many diffs) n/a
2 ccsbBroad304_12401 pLX_304 0% 52.3% 46.1% V5 (many diffs) n/a
3 TRCN0000465929 CAAGTCACTTTGCCATTGTGTCTT pLX_317 37% 52.3% 46.1% V5 (many diffs) n/a
Download CSV