Transcript: Human NM_021025.4

Homo sapiens T cell leukemia homeobox 3 (TLX3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TLX3 (30012)
Length:
1534
CDS:
119..994

Additional Resources:

NCBI RefSeq record:
NM_021025.4
NBCI Gene record:
TLX3 (30012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021025.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378342 AGCCTTGGCGGTCTCAATTTC pLKO_005 473 CDS 100% 13.200 18.480 N TLX3 n/a
2 TRCN0000367867 CCTGACAAGAAAGCGCCTTAC pLKO_005 1230 3UTR 100% 6.000 4.800 N TLX3 n/a
3 TRCN0000367868 GCTTCGTGAAAGACCGCTTCA pLKO_005 516 CDS 100% 4.050 2.835 N TLX3 n/a
4 TRCN0000070957 CCCGCACGAGCCCATCAGCTT pLKO.1 151 CDS 100% 0.000 0.000 N Tlx3 n/a
5 TRCN0000018031 CGGCTCATGCTGCAGCTGCAA pLKO.1 830 CDS 100% 0.000 0.000 N TLX3 n/a
6 TRCN0000018032 GCAGCTGCAACACGACGCCTT pLKO.1 841 CDS 100% 0.000 0.000 N TLX3 n/a
7 TRCN0000018030 GCGCTCGCCAAGTCCCTCAAA pLKO.1 710 CDS 100% 0.000 0.000 N TLX3 n/a
8 TRCN0000367824 TGCACAACTCGTCACTCTTTG pLKO_005 906 CDS 100% 10.800 6.480 N TLX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021025.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03131 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03131 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468404 CTGAGAATCGAGCATCCTCACCCA pLX_317 44% 100% 100% V5 n/a
Download CSV