Transcript: Human NM_021149.5

Homo sapiens coactosin like F-actin binding protein 1 (COTL1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
COTL1 (23406)
Length:
1842
CDS:
165..593

Additional Resources:

NCBI RefSeq record:
NM_021149.5
NBCI Gene record:
COTL1 (23406)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021149.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072550 GTTTGTGATCAGTGATCGGAA pLKO.1 497 CDS 100% 2.640 3.696 N COTL1 n/a
2 TRCN0000310158 GTTTGTGATCAGTGATCGGAA pLKO_005 497 CDS 100% 2.640 3.696 N COTL1 n/a
3 TRCN0000072551 CGTACAGAATTTCGCTAAGGA pLKO.1 476 CDS 100% 3.000 2.400 N COTL1 n/a
4 TRCN0000291956 CGTACAGAATTTCGCTAAGGA pLKO_005 476 CDS 100% 3.000 2.400 N COTL1 n/a
5 TRCN0000072552 AGATTTCATCAAGAGCGAGCT pLKO.1 530 CDS 100% 2.160 1.728 N COTL1 n/a
6 TRCN0000291958 AGATTTCATCAAGAGCGAGCT pLKO_005 530 CDS 100% 2.160 1.728 N COTL1 n/a
7 TRCN0000072548 CCTCTTTCTTTGATCTTCTTT pLKO.1 799 3UTR 100% 5.625 3.938 N COTL1 n/a
8 TRCN0000292021 CCTCTTTCTTTGATCTTCTTT pLKO_005 799 3UTR 100% 5.625 3.938 N COTL1 n/a
9 TRCN0000072549 CATGAGCAAGAGGTCCAAGTT pLKO.1 371 CDS 100% 4.950 2.970 N COTL1 n/a
10 TRCN0000291957 CATGAGCAAGAGGTCCAAGTT pLKO_005 371 CDS 100% 4.950 2.970 N COTL1 n/a
11 TRCN0000184102 CCAAGTTTGCCCTCATCACAT pLKO.1 385 CDS 100% 4.950 3.465 N Cotl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021149.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07879 pDONR223 100% 99.7% 99.2% None 13A>T n/a
2 ccsbBroad304_07879 pLX_304 0% 99.7% 99.2% V5 13A>T n/a
3 TRCN0000469021 ATTCTACCGAGCATCACCAGCTCC pLX_317 87.6% 99.7% 99.2% V5 13A>T n/a
Download CSV