Transcript: Human NM_021165.4

Homo sapiens BMP/retinoic acid inducible neural specific 2 (BRINP2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
BRINP2 (57795)
Length:
4097
CDS:
852..3203

Additional Resources:

NCBI RefSeq record:
NM_021165.4
NBCI Gene record:
BRINP2 (57795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021165.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372230 CCAGTTGGACTACCCATATAC pLKO_005 2957 CDS 100% 13.200 18.480 N BRINP2 n/a
2 TRCN0000150117 CCAGAGAACAAAGTACAGTTA pLKO.1 1602 CDS 100% 4.950 6.930 N BRINP2 n/a
3 TRCN0000377808 CAGAGTTTATCCGGAACATTC pLKO_005 1198 CDS 100% 10.800 8.640 N BRINP2 n/a
4 TRCN0000372229 CAGATGCTATCCGGGACTTAA pLKO_005 2932 CDS 100% 13.200 9.240 N BRINP2 n/a
5 TRCN0000372173 TTAACACCTTGCAGGTCTTTG pLKO_005 2890 CDS 100% 10.800 7.560 N BRINP2 n/a
6 TRCN0000147065 CCTGACATTGGTTCTTACTTT pLKO.1 3691 3UTR 100% 5.625 3.938 N BRINP2 n/a
7 TRCN0000148085 GCCAAGGAAGAGATTAAGAAA pLKO.1 3500 3UTR 100% 5.625 3.938 N BRINP2 n/a
8 TRCN0000147290 GAGACAGTTCATGTTTACCTA pLKO.1 2769 CDS 100% 3.000 2.100 N BRINP2 n/a
9 TRCN0000178993 CGAAGAAAGAAGCTCTGTCAA pLKO.1 3930 3UTR 100% 4.950 2.970 N BRINP2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3396 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021165.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03851 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03851 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480535 CGTCGCCGTGGAGAATCTTTGATA pLX_317 17.8% 100% 100% V5 n/a
Download CSV