Transcript: Human NM_021183.5

Homo sapiens RAP2C, member of RAS oncogene family (RAP2C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RAP2C (57826)
Length:
3805
CDS:
657..1208

Additional Resources:

NCBI RefSeq record:
NM_021183.5
NBCI Gene record:
RAP2C (57826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021183.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419476 CACGTTTACCATACGTTTAAA pLKO_005 1415 3UTR 100% 15.000 21.000 N RAP2C n/a
2 TRCN0000366700 TCGTCAGGCAAATGAACTATT pLKO_005 1135 CDS 100% 13.200 18.480 N Rap2c n/a
3 TRCN0000048175 CCCACTAATCCTAGTAGGAAA pLKO.1 983 CDS 100% 4.950 6.930 N RAP2C n/a
4 TRCN0000048176 CATTGAAGATTTCTACCGCAA pLKO.1 761 CDS 100% 2.160 3.024 N RAP2C n/a
5 TRCN0000048174 GCCTGGTTAATCAACAGTCTT pLKO.1 904 CDS 100% 4.950 3.960 N RAP2C n/a
6 TRCN0000422345 GCTAATATACAAGGGTTAATT pLKO_005 1488 3UTR 100% 15.000 10.500 N RAP2C n/a
7 TRCN0000436764 CAGAGCTCTGGCTCAAGAATG pLKO_005 1049 CDS 100% 10.800 7.560 N RAP2C n/a
8 TRCN0000048173 CCTGGTTTATAGCCTGGTTAA pLKO.1 893 CDS 100% 10.800 7.560 N RAP2C n/a
9 TRCN0000048177 AGAAGCAAGATCAGTGTTGTA pLKO.1 1168 CDS 100% 4.950 3.465 N RAP2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021183.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08770 pDONR223 100% 99.8% 99.4% None 404C>T n/a
2 ccsbBroad304_08770 pLX_304 0% 99.8% 99.4% V5 404C>T n/a
3 TRCN0000466597 GGCAAACCACCGGTAATATGTCGA pLX_317 51.3% 99.8% 99.4% V5 404C>T n/a
Download CSV