Transcript: Human NM_021191.3

Homo sapiens neuronal differentiation 4 (NEUROD4), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
NEUROD4 (58158)
Length:
3927
CDS:
350..1345

Additional Resources:

NCBI RefSeq record:
NM_021191.3
NBCI Gene record:
NEUROD4 (58158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017628 GCTCGAAGAGTCAAGGCTAAT pLKO.1 608 CDS 100% 10.800 15.120 N NEUROD4 n/a
2 TRCN0000414859 GCATAATCTGTGCCAATTAAT pLKO_005 1632 3UTR 100% 15.000 12.000 N NEUROD4 n/a
3 TRCN0000418411 GAGAGCAGACCAGGTACTTAT pLKO_005 452 CDS 100% 13.200 9.240 N NEUROD4 n/a
4 TRCN0000017631 CCTGAGCATCAGTGGGAACTT pLKO.1 1117 CDS 100% 4.950 3.465 N NEUROD4 n/a
5 TRCN0000075597 CTTTCCAAGATAGAGACTCTT pLKO.1 716 CDS 100% 4.950 3.465 N Neurod4 n/a
6 TRCN0000017629 GCACGAGGATAAATCTCCTAT pLKO.1 904 CDS 100% 4.950 3.465 N NEUROD4 n/a
7 TRCN0000017632 TCATGCCACATTACCCTTCTT pLKO.1 1185 CDS 100% 4.950 3.465 N NEUROD4 n/a
8 TRCN0000017630 CCAGGAACTATATTTGGGCTT pLKO.1 744 CDS 100% 2.160 1.296 N NEUROD4 n/a
9 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 515 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12411 pDONR223 100% 77% 77% None 1_228del n/a
2 ccsbBroad304_12411 pLX_304 0% 77% 77% V5 1_228del n/a
3 TRCN0000476651 GATGCCGCAGTATTATAAACGGGT pLX_317 43.1% 77% 77% V5 1_228del n/a
Download CSV