Transcript: Human NM_021203.4

Homo sapiens SRP receptor subunit beta (SRPRB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SRPRB (58477)
Length:
2837
CDS:
296..1111

Additional Resources:

NCBI RefSeq record:
NM_021203.4
NBCI Gene record:
SRPRB (58477)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021203.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063104 GCTAGTCTTCTGGAAGTTAAT pLKO.1 445 CDS 100% 13.200 10.560 N SRPRB n/a
2 TRCN0000299315 GCTAGTCTTCTGGAAGTTAAT pLKO_005 445 CDS 100% 13.200 10.560 N SRPRB n/a
3 TRCN0000063103 GCCTGCAATAAGCAAGATATT pLKO.1 827 CDS 100% 13.200 9.240 N SRPRB n/a
4 TRCN0000299238 GCCTGCAATAAGCAAGATATT pLKO_005 827 CDS 100% 13.200 9.240 N SRPRB n/a
5 TRCN0000063107 CAGGTTGTTAACAGGCCTTTA pLKO.1 541 CDS 100% 10.800 7.560 N SRPRB n/a
6 TRCN0000299316 CAGGTTGTTAACAGGCCTTTA pLKO_005 541 CDS 100% 10.800 7.560 N SRPRB n/a
7 TRCN0000063106 GCTTCAGTTCTTAGAGCGGTT pLKO.1 670 CDS 100% 2.160 1.512 N SRPRB n/a
8 TRCN0000299240 GCTTCAGTTCTTAGAGCGGTT pLKO_005 670 CDS 100% 2.160 1.512 N SRPRB n/a
9 TRCN0000063105 GTGAAAGATGTGGCTGAGTTT pLKO.1 749 CDS 100% 4.950 2.970 N SRPRB n/a
10 TRCN0000299239 GTGAAAGATGTGGCTGAGTTT pLKO_005 749 CDS 100% 4.950 2.970 N SRPRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021203.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03858 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03858 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491785 AGACTTCGCCCGACGGAGCAGGAC pLX_317 34.8% 100% 100% V5 n/a
Download CSV