Transcript: Human NM_021224.6

Homo sapiens zinc finger protein 462 (ZNF462), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF462 (58499)
Length:
10345
CDS:
221..7741

Additional Resources:

NCBI RefSeq record:
NM_021224.6
NBCI Gene record:
ZNF462 (58499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021224.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414171 AGATCAACAACGCGATGATAT pLKO_005 3075 CDS 100% 13.200 18.480 N ZNF462 n/a
2 TRCN0000427100 GTGTAGTAACTGCCGACAAAT pLKO_005 7686 CDS 100% 13.200 18.480 N ZNF462 n/a
3 TRCN0000107906 GCCACGACATTGATGCGTATT pLKO.1 5376 CDS 100% 10.800 15.120 N ZNF462 n/a
4 TRCN0000095830 CCGCTGTGATAAGTGTACCTT pLKO.1 7120 CDS 100% 3.000 4.200 N Zfp462 n/a
5 TRCN0000419085 GACTCCAATGACTCATCATAT pLKO_005 6638 CDS 100% 13.200 10.560 N ZNF462 n/a
6 TRCN0000415242 TTAGGACTGAACAATCTATTT pLKO_005 7856 3UTR 100% 13.200 10.560 N ZNF462 n/a
7 TRCN0000107908 GCGCAGCATCTTAGAGTCTAT pLKO.1 895 CDS 100% 4.950 3.960 N ZNF462 n/a
8 TRCN0000423999 GTATGCCAATCTGAGTATAAC pLKO_005 4640 CDS 100% 13.200 9.240 N ZNF462 n/a
9 TRCN0000417270 AGAAGCTCCATGACGGTAGAA pLKO_005 8071 3UTR 100% 4.950 3.465 N ZNF462 n/a
10 TRCN0000107905 CGGATCTTCATCATGGAAGTT pLKO.1 7973 3UTR 100% 4.950 3.465 N ZNF462 n/a
11 TRCN0000107907 CCCGAATGTTAGAAGCCTGAT pLKO.1 3022 CDS 100% 4.050 2.835 N ZNF462 n/a
12 TRCN0000107909 GCGCAACATGATTGACCACAT pLKO.1 7018 CDS 100% 4.050 2.835 N ZNF462 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021224.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12414 pDONR223 100% 35.2% 35.2% None 1_4866del;5483A>G;7218T>A n/a
2 ccsbBroad304_12414 pLX_304 0% 35.2% 35.2% V5 1_4866del;5483A>G;7218T>A n/a
3 TRCN0000471691 GTTTATACCTGTTCAGACCGAGCT pLX_317 16.5% 35.2% 35.2% V5 1_4866del;5483A>G;7218T>A n/a
Download CSV