Transcript: Mouse NM_021320.3

Mus musculus netrin 4 (Ntn4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ntn4 (57764)
Length:
2411
CDS:
406..2292

Additional Resources:

NCBI RefSeq record:
NM_021320.3
NBCI Gene record:
Ntn4 (57764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094826 CGTCTAGATACTCAAATCCTT pLKO.1 950 CDS 100% 3.000 2.400 N Ntn4 n/a
2 TRCN0000094827 GCCCAAGTGTGATAAATGCAA pLKO.1 627 CDS 100% 3.000 2.400 N Ntn4 n/a
3 TRCN0000094825 CCTTCTGTGGAATGAAGTATT pLKO.1 1958 CDS 100% 13.200 9.240 N Ntn4 n/a
4 TRCN0000370307 TTCTACTTCACTCACCTAATT pLKO_005 778 CDS 100% 13.200 9.240 N NTN4 n/a
5 TRCN0000453788 TTGTCAAGAAGGGAGCTATTT pLKO_005 926 CDS 100% 13.200 9.240 N Ntn4 n/a
6 TRCN0000094828 ACTCAGGTAAATGTGAATGTA pLKO.1 1910 CDS 100% 5.625 3.938 N Ntn4 n/a
7 TRCN0000094824 GCAGACTCATCCTTCAGGTTT pLKO.1 688 CDS 100% 4.950 3.465 N Ntn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.