Transcript: Mouse NM_021345.2

Mus musculus 3-hydroxyacyl-CoA dehydratase 3 (Hacd3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hacd3 (57874)
Length:
2738
CDS:
175..1263

Additional Resources:

NCBI RefSeq record:
NM_021345.2
NBCI Gene record:
Hacd3 (57874)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030060 CGCCTAAATAAACTCAGACTA pLKO.1 553 CDS 100% 4.950 6.930 N Hacd3 n/a
2 TRCN0000320261 CGCCTAAATAAACTCAGACTA pLKO_005 553 CDS 100% 4.950 6.930 N Hacd3 n/a
3 TRCN0000030059 GCTCCGTTACACTATGTGGAT pLKO.1 1002 CDS 100% 2.640 3.696 N Hacd3 n/a
4 TRCN0000320337 GCTCCGTTACACTATGTGGAT pLKO_005 1002 CDS 100% 2.640 3.696 N Hacd3 n/a
5 TRCN0000030062 CCAGTCCATTCCAGTATTCAA pLKO.1 1068 CDS 100% 5.625 4.500 N Hacd3 n/a
6 TRCN0000030061 CCTTCAAGTTTATCTCGTAAT pLKO.1 1155 CDS 100% 10.800 7.560 N Hacd3 n/a
7 TRCN0000320262 CCTTCAAGTTTATCTCGTAAT pLKO_005 1155 CDS 100% 10.800 7.560 N Hacd3 n/a
8 TRCN0000030063 GCACCATGGAAGAAATGCAAA pLKO.1 872 CDS 100% 4.950 3.465 N Hacd3 n/a
9 TRCN0000320336 GCACCATGGAAGAAATGCAAA pLKO_005 872 CDS 100% 4.950 3.465 N Hacd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.