Transcript: Mouse NM_021362.1

Mus musculus pregnancy-associated plasma protein A (Pappa), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Pappa (18491)
Length:
11027
CDS:
369..5243

Additional Resources:

NCBI RefSeq record:
NM_021362.1
NBCI Gene record:
Pappa (18491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032782 GCTGGAATTTCGCTACCCTTT pLKO.1 2711 CDS 100% 4.050 5.670 N Pappa n/a
2 TRCN0000341126 GTACCGGATTATCACCATTTC pLKO_005 3119 CDS 100% 0.000 0.000 N Pappa n/a
3 TRCN0000032780 GCGGCTGATGAAGCTCTATAT pLKO.1 974 CDS 100% 13.200 10.560 N Pappa n/a
4 TRCN0000341130 ACGACATGAATAAGGTCAATG pLKO_005 3241 CDS 100% 10.800 8.640 N Pappa n/a
5 TRCN0000341127 GAGCAAGTAGGTGGCATATTC pLKO_005 1023 CDS 100% 13.200 9.240 N Pappa n/a
6 TRCN0000341057 TCCGAACCTGGAGTCCAAATT pLKO_005 2629 CDS 100% 13.200 9.240 N Pappa n/a
7 TRCN0000341056 TGAACCCAGCCGGTGCTATTT pLKO_005 3314 CDS 100% 13.200 9.240 N Pappa n/a
8 TRCN0000046710 GCTGTATGACAAATGTTCTTA pLKO.1 776 CDS 100% 5.625 3.938 N PAPPA n/a
9 TRCN0000032783 CCTGGAGATTGATGCAGCAAT pLKO.1 2942 CDS 100% 4.950 3.465 N Pappa n/a
10 TRCN0000032779 GCCACTTCTTTGAAAGAGAAT pLKO.1 2455 CDS 100% 4.950 3.465 N Pappa n/a
11 TRCN0000032781 CCAGTTACAATCAGCTCCCAA pLKO.1 1375 CDS 100% 2.640 1.848 N Pappa n/a
12 TRCN0000127737 GCTAATCAAGAGCCAGGTATT pLKO.1 4124 CDS 100% 10.800 8.640 N ANKRD12 n/a
13 TRCN0000430558 TTGGCAGTGTGTACCAGTATT pLKO_005 3103 CDS 100% 13.200 7.920 N PAPPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.