Transcript: Mouse NM_021411.4

Mus musculus RAB37, member RAS oncogene family (Rab37), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rab37 (58222)
Length:
2193
CDS:
22..693

Additional Resources:

NCBI RefSeq record:
NM_021411.4
NBCI Gene record:
Rab37 (58222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100817 GACGTGGTGATTATGCTTCTA pLKO.1 424 CDS 100% 4.950 6.930 N Rab37 n/a
2 TRCN0000379684 GCTTCCAGATCCGAGACTATG pLKO_005 629 CDS 100% 10.800 8.640 N Rab37 n/a
3 TRCN0000382356 CCAAAGCCTTGGGCAAGATAA pLKO_005 1163 3UTR 100% 13.200 9.240 N Rab37 n/a
4 TRCN0000381305 AGGCAACAAGGCCGATGTAAG pLKO_005 444 CDS 100% 10.800 7.560 N Rab37 n/a
5 TRCN0000047906 AGCTTCCAGATCCGAGACTAT pLKO.1 628 CDS 100% 4.950 3.465 N RAB37 n/a
6 TRCN0000100815 GCAGAACTGAACAAAGCCATA pLKO.1 1547 3UTR 100% 4.050 2.835 N Rab37 n/a
7 TRCN0000100816 CCAGGGAATATGGTGTTCCTT pLKO.1 506 CDS 100% 3.000 2.100 N Rab37 n/a
8 TRCN0000381640 CGCAGTGTGACCCATGCTTAT pLKO_005 298 CDS 100% 10.800 6.480 N Rab37 n/a
9 TRCN0000100818 GCCCAGAGAGACGTGGTGATT pLKO.1 415 CDS 100% 1.650 0.990 N Rab37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05423 pDONR223 100% 88.9% 93.7% None (many diffs) n/a
2 ccsbBroad304_05423 pLX_304 0% 88.9% 93.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000471971 ACTCCGCCGCGTCAATCGCGAACT pLX_317 71.7% 88.9% 93.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV