Transcript: Mouse NM_021455.4

Mus musculus MLX interacting protein-like (Mlxipl), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mlxipl (58805)
Length:
3649
CDS:
33..2627

Additional Resources:

NCBI RefSeq record:
NM_021455.4
NBCI Gene record:
Mlxipl (58805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021455.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082204 CCGCAGGATACAGTTTCTGAA pLKO.1 1731 CDS 100% 4.950 6.930 N Mlxipl n/a
2 TRCN0000082207 ACCCACATCTTCAAACTACAT pLKO.1 965 CDS 100% 4.950 3.960 N Mlxipl n/a
3 TRCN0000218938 AGAAGAGGCGGTTCAATATTA pLKO_005 2044 CDS 100% 15.000 10.500 N Mlxipl n/a
4 TRCN0000082203 CCTCTGGAATACTGGAATTAA pLKO.1 3430 3UTR 100% 15.000 10.500 N Mlxipl n/a
5 TRCN0000234183 TGTCATCCTGGAGGGTAATTA pLKO_005 518 CDS 100% 15.000 10.500 N Mlxipl n/a
6 TRCN0000234186 ATGATCCCTGGTGACTCATAT pLKO_005 2791 3UTR 100% 13.200 9.240 N Mlxipl n/a
7 TRCN0000082206 GCATCCTCATCCGACCTTTAT pLKO.1 2383 CDS 100% 13.200 9.240 N Mlxipl n/a
8 TRCN0000234185 AGCATCCTCATCCGACCTTTA pLKO_005 2382 CDS 100% 10.800 7.560 N Mlxipl n/a
9 TRCN0000234184 GGACTGCTTCTTGTCCGATAT pLKO_005 767 CDS 100% 10.800 7.560 N Mlxipl n/a
10 TRCN0000082205 CCTCTTTGTTGCCAGAAGAAT pLKO.1 1312 CDS 100% 5.625 3.938 N Mlxipl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021455.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.