Transcript: Mouse NM_021492.3

Mus musculus adaptor-related protein complex 3, beta 2 subunit (Ap3b2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ap3b2 (11775)
Length:
3816
CDS:
306..3554

Additional Resources:

NCBI RefSeq record:
NM_021492.3
NBCI Gene record:
Ap3b2 (11775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380857 CCACTACTGTGATGGGCATTA pLKO_005 3106 CDS 100% 10.800 15.120 N Ap3b2 n/a
2 TRCN0000306878 CGTTATGCGCGAACGCAATTC pLKO_005 1038 CDS 100% 10.800 15.120 N Ap3b2 n/a
3 TRCN0000294634 GACGATGTGCAACGAACATAG pLKO_005 1606 CDS 100% 10.800 15.120 N Ap3b2 n/a
4 TRCN0000294633 TACGTGTATCTGGTCCGATAT pLKO_005 585 CDS 100% 10.800 15.120 N Ap3b2 n/a
5 TRCN0000100719 CCAGAACGTATTGACCTGATT pLKO.1 936 CDS 100% 4.950 6.930 N Ap3b2 n/a
6 TRCN0000100718 CCCTATGTAATGGACCCAGAT pLKO.1 1188 CDS 100% 4.050 5.670 N Ap3b2 n/a
7 TRCN0000306894 CAGAGTCAGTGGTGGTCATTA pLKO_005 1696 CDS 100% 13.200 9.240 N Ap3b2 n/a
8 TRCN0000380943 CGCTCGGAAGCCCTATGTAAT pLKO_005 1178 CDS 100% 13.200 9.240 N Ap3b2 n/a
9 TRCN0000382450 GAATGGACCAAATGTTCAAAT pLKO_005 2283 CDS 100% 13.200 9.240 N Ap3b2 n/a
10 TRCN0000100716 CCTGTATTTATGAGTGAGAAT pLKO.1 3225 CDS 100% 4.950 3.465 N Ap3b2 n/a
11 TRCN0000100717 CCTTCAAAGATCGTGACCATT pLKO.1 2149 CDS 100% 4.950 3.465 N Ap3b2 n/a
12 TRCN0000100715 GCACTGTTACCCACTGATCTT pLKO.1 3562 3UTR 100% 4.950 2.970 N Ap3b2 n/a
13 TRCN0000287130 GCACTGTTACCCACTGATCTT pLKO_005 3562 3UTR 100% 4.950 2.970 N Ap3b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13990 pDONR223 100% 88.9% 76.1% None (many diffs) n/a
2 ccsbBroad304_13990 pLX_304 0% 88.9% 76.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476411 GTACTTGAACTTTGCCACTTTCAG pLX_317 11.5% 88.9% 76.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV