Transcript: Mouse NM_021502.2

Mus musculus trafficking protein particle complex 2-like (Trappc2l), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trappc2l (59005)
Length:
634
CDS:
36..455

Additional Resources:

NCBI RefSeq record:
NM_021502.2
NBCI Gene record:
Trappc2l (59005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246564 GGTCGTGGATTCCTCCAATAC pLKO_005 281 CDS 100% 10.800 8.640 N Trappc2l n/a
2 TRCN0000190180 CCGGAAGCTGCATAACTCTTA pLKO.1 335 CDS 100% 4.950 3.960 N Trappc2l n/a
3 TRCN0000246563 ACCAATTCCAAGGTGAAATTT pLKO_005 255 CDS 100% 15.000 10.500 N Trappc2l n/a
4 TRCN0000246565 ACCGAGGACTACAAGGTATAT pLKO_005 225 CDS 100% 13.200 9.240 N Trappc2l n/a
5 TRCN0000246562 GACAACGAGATCCGCAGTATG pLKO_005 312 CDS 100% 10.800 7.560 N Trappc2l n/a
6 TRCN0000202272 GCTCAAGTTCCACTACATGGT pLKO.1 110 CDS 100% 2.640 1.848 N Trappc2l n/a
7 TRCN0000246561 GCCTGCCTCAGTCGTTCAGAA pLKO_005 468 3UTR 100% 1.650 1.155 N Trappc2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12006 pDONR223 100% 89.4% 98.5% None (many diffs) n/a
2 ccsbBroad304_12006 pLX_304 0% 89.4% 98.5% V5 (many diffs) n/a
3 TRCN0000474517 TTCGGCCATTGGACGTGCAAAACG pLX_317 97.4% 89.4% 98.5% V5 (many diffs) n/a
Download CSV