Transcript: Mouse NM_021511.2

Mus musculus ribosome biogenesis regulator 1 (Rrs1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rrs1 (59014)
Length:
2058
CDS:
117..1214

Additional Resources:

NCBI RefSeq record:
NM_021511.2
NBCI Gene record:
Rrs1 (59014)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103977 CCCGGGATGACACTAAAGAAT pLKO.1 562 CDS 100% 5.625 3.938 N Rrs1 n/a
2 TRCN0000294597 AGTAACCTGGGCACCAATATG pLKO_005 1645 3UTR 100% 13.200 7.920 N Rrs1 n/a
3 TRCN0000103976 CGAGTCATGAACAGCAAGAAA pLKO.1 933 CDS 100% 5.625 3.375 N Rrs1 n/a
4 TRCN0000103979 TCCGGCAAGAAGAGGAAGTTT pLKO.1 858 CDS 100% 5.625 3.375 N Rrs1 n/a
5 TRCN0000103975 GCCCTCAGTGACATTTGACAT pLKO.1 1290 3UTR 100% 4.950 2.970 N Rrs1 n/a
6 TRCN0000294528 AGAGGAGGAAGTAGCGTTCTC pLKO_005 1201 CDS 100% 4.050 2.430 N Rrs1 n/a
7 TRCN0000103978 GCCTTCTGCTTTAGCTGGCAA pLKO.1 1151 CDS 100% 2.640 1.584 N Rrs1 n/a
8 TRCN0000294596 AGAGGACTCAGGCCAAGAAAG pLKO_005 634 CDS 100% 10.800 5.400 Y Rrs1 n/a
9 TRCN0000294526 CCTACTGGACACCAGAGTAAG pLKO_005 741 CDS 100% 10.800 5.400 Y Rrs1 n/a
10 TRCN0000294595 CAACACGCAGCTGCTCATCAA pLKO_005 317 CDS 100% 4.950 2.475 Y Rrs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02738 pDONR223 100% 88.1% 90.6% None (many diffs) n/a
2 ccsbBroad304_02738 pLX_304 0% 88.1% 90.6% V5 (many diffs) n/a
3 TRCN0000470928 AGATTGCCTCTATGTGAATTCAGC pLX_317 47.3% 88.1% 90.6% V5 (many diffs) n/a
Download CSV