Transcript: Mouse NM_021528.3

Mus musculus carbohydrate sulfotransferase 12 (Chst12), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Chst12 (59031)
Length:
1802
CDS:
168..1427

Additional Resources:

NCBI RefSeq record:
NM_021528.3
NBCI Gene record:
Chst12 (59031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103373 TGGAGGCAACAGCTCTATAAA pLKO.1 1344 CDS 100% 15.000 12.000 N Chst12 n/a
2 TRCN0000302969 TGGAGGCAACAGCTCTATAAA pLKO_005 1344 CDS 100% 15.000 12.000 N Chst12 n/a
3 TRCN0000103374 GATCATTGTATATTGGGACAA pLKO.1 230 CDS 100% 4.050 3.240 N Chst12 n/a
4 TRCN0000302962 GATCATTGTATATTGGGACAA pLKO_005 230 CDS 100% 4.050 3.240 N Chst12 n/a
5 TRCN0000103372 CAACGACCTTTCCAGGAGAAA pLKO.1 401 CDS 100% 4.950 3.465 N Chst12 n/a
6 TRCN0000302886 CAACGACCTTTCCAGGAGAAA pLKO_005 401 CDS 100% 4.950 3.465 N Chst12 n/a
7 TRCN0000103371 GCACCTCACCTTCAACAAGTT pLKO.1 818 CDS 100% 4.950 3.465 N Chst12 n/a
8 TRCN0000302970 GCACCTCACCTTCAACAAGTT pLKO_005 818 CDS 100% 4.950 3.465 N Chst12 n/a
9 TRCN0000103370 CCCAACAAATTGAATGGCTGT pLKO.1 1452 3UTR 100% 2.160 1.512 N Chst12 n/a
10 TRCN0000302873 CCCAACAAATTGAATGGCTGT pLKO_005 1452 3UTR 100% 2.160 1.512 N Chst12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03592 pDONR223 100% 82.5% 82.8% None (many diffs) n/a
2 ccsbBroad304_03592 pLX_304 0% 82.5% 82.8% V5 (many diffs) n/a
3 TRCN0000480263 ATTAGACCATCAATGAGCTGTCCT pLX_317 28.2% 82.5% 82.8% V5 (many diffs) n/a
Download CSV