Transcript: Human NM_021724.5

Homo sapiens nuclear receptor subfamily 1 group D member 1 (NR1D1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NR1D1 (9572)
Length:
2630
CDS:
496..2340

Additional Resources:

NCBI RefSeq record:
NM_021724.5
NBCI Gene record:
NR1D1 (9572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021724.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437678 ATTGCTCCATCGTCCGCATCA pLKO_005 1016 CDS 100% 4.050 5.670 N NR1D1 n/a
2 TRCN0000419994 CCCTTGTACAGAATCGAACTC pLKO_005 2369 3UTR 100% 4.050 5.670 N NR1D1 n/a
3 TRCN0000455011 GATCTTCACCTACGCCCATGA pLKO_005 1389 CDS 100% 4.050 5.670 N NR1D1 n/a
4 TRCN0000022177 CCAGCCCTGAATCCCTCTATA pLKO.1 575 CDS 100% 13.200 9.240 N NR1D1 n/a
5 TRCN0000022178 CGTCATAACGAGGCCCTAAAT pLKO.1 1543 CDS 100% 13.200 9.240 N NR1D1 n/a
6 TRCN0000416055 TCTATAGTGACAACTCCAATG pLKO_005 590 CDS 100% 6.000 4.200 N NR1D1 n/a
7 TRCN0000022174 CCAGCAGAACATCCAGTACAA pLKO.1 975 CDS 100% 4.950 3.465 N NR1D1 n/a
8 TRCN0000022176 GCGCTTTGCTTCGTTGTTCAA pLKO.1 1941 CDS 100% 4.950 3.465 N NR1D1 n/a
9 TRCN0000022175 GCTGGCATGTCCTATGAACAT pLKO.1 1740 CDS 100% 4.950 3.465 N NR1D1 n/a
10 TRCN0000437811 CAGTGCCATGTTCGACTTCAG pLKO_005 2046 CDS 100% 4.050 2.835 N NR1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021724.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489256 AAGCTAGACCGGCCGTAGCTCACA pLX_317 15.5% 99.9% 99.8% V5 1842_1843insG n/a
Download CSV