Transcript: Human NM_021801.4

Homo sapiens matrix metallopeptidase 26 (MMP26), mRNA.

Source:
NCBI, updated 2019-06-23
Taxon:
Homo sapiens (human)
Gene:
MMP26 (56547)
Length:
1001
CDS:
22..807

Additional Resources:

NCBI RefSeq record:
NM_021801.4
NBCI Gene record:
MMP26 (56547)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021801.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051420 GAGGGCTATTTCCATCAATTT pLKO.1 118 CDS 100% 13.200 18.480 N MMP26 n/a
2 TRCN0000051422 CCTGCAACAATTCCATCGGAA pLKO.1 192 CDS 100% 2.640 3.696 N MMP26 n/a
3 TRCN0000051418 CCGCAGTGAAAGACAGTATAT pLKO.1 374 CDS 100% 13.200 10.560 N MMP26 n/a
4 TRCN0000434059 TGTCCTTTCAGGGAGTTTATT pLKO_005 834 3UTR 100% 15.000 10.500 N MMP26 n/a
5 TRCN0000434750 GTTCATCTGACATACCTTAAT pLKO_005 788 CDS 100% 13.200 9.240 N MMP26 n/a
6 TRCN0000051421 CCTGGTTGCAACTCATGAGAT pLKO.1 630 CDS 100% 4.950 3.465 N MMP26 n/a
7 TRCN0000051419 GCACACTCTAACTTACAGGAT pLKO.1 324 CDS 100% 2.640 1.848 N MMP26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021801.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03726 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03726 pLX_304 0% 100% 100% V5 n/a
Download CSV