Transcript: Human NM_021818.4

Homo sapiens salvador family WW domain containing protein 1 (SAV1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SAV1 (60485)
Length:
3094
CDS:
340..1491

Additional Resources:

NCBI RefSeq record:
NM_021818.4
NBCI Gene record:
SAV1 (60485)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152173 CATCCGAATTTGGAACCTATT pLKO.1 1073 CDS 100% 10.800 15.120 N SAV1 n/a
2 TRCN0000151949 CGTGAAACTCAAAGTTGCTAA pLKO.1 2458 3UTR 100% 4.950 3.960 N SAV1 n/a
3 TRCN0000153689 CCCTTCTTACAGAGTTGGAAA pLKO.1 1418 CDS 100% 4.950 3.465 N SAV1 n/a
4 TRCN0000152604 GCAGGAATACTTAGCCTGTAT pLKO.1 2427 3UTR 100% 4.950 3.465 N SAV1 n/a
5 TRCN0000154682 GCTTCAGGTATTGGGAGAGTT pLKO.1 868 CDS 100% 4.950 3.465 N SAV1 n/a
6 TRCN0000152694 GCTGCTTCCTTTGTGGAAATT pLKO.1 1580 3UTR 100% 13.200 7.920 N SAV1 n/a
7 TRCN0000151570 GCACATGAAGACTACAGATAT pLKO.1 793 CDS 100% 13.200 6.600 Y SAV1 n/a
8 TRCN0000152343 CCATGATCTCTTCCAAAGAAT pLKO.1 825 CDS 100% 5.625 2.813 Y SAV1 n/a
9 TRCN0000151135 CAGTCATTTGTAACGGAAGTT pLKO.1 679 CDS 100% 4.950 2.475 Y SAV1 n/a
10 TRCN0000155279 GCACCTTCTTATCTTGCCAGA pLKO.1 622 CDS 100% 2.160 1.080 Y SAV1 n/a
11 TRCN0000155278 GTCTTCCAGATTCAAGCCCTA pLKO.1 491 CDS 100% 2.160 1.080 Y SAV1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03888 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03888 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467208 ACCTCCAGTCGTTTCTAGCTACTG pLX_317 14.1% 100% 100% V5 n/a
Download CSV