Transcript: Human NM_021823.5

Homo sapiens phosphopantothenoylcysteine decarboxylase (PPCDC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
PPCDC (60490)
Length:
2215
CDS:
110..724

Additional Resources:

NCBI RefSeq record:
NM_021823.5
NBCI Gene record:
PPCDC (60490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021823.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338747 ACGCTGATGAATGGGAGATAT pLKO_005 324 CDS 100% 13.200 18.480 N PPCDC n/a
2 TRCN0000350991 ATAGGAGGATACCCTCATTTG pLKO_005 803 3UTR 100% 10.800 8.640 N PPCDC n/a
3 TRCN0000338683 TTGCCTCTTCTGGTGTCAAAG pLKO_005 206 CDS 100% 10.800 7.560 N PPCDC n/a
4 TRCN0000152453 CAACTGAGAGAGCCAAACATT pLKO.1 264 CDS 100% 5.625 3.938 N PPCDC n/a
5 TRCN0000155902 CAGTGGCATCTGTGACAACTT pLKO.1 445 CDS 100% 4.950 3.465 N PPCDC n/a
6 TRCN0000155737 CCAGAGAGCTTTCCTAGCATT pLKO.1 1611 3UTR 100% 4.950 3.465 N PPCDC n/a
7 TRCN0000155901 CCTTGGGAGTTTCAGCTCTTT pLKO.1 1091 3UTR 100% 4.950 3.465 N PPCDC n/a
8 TRCN0000152926 CGTGGACAAAGTGAAAGAAGT pLKO.1 670 CDS 100% 4.950 3.465 N PPCDC n/a
9 TRCN0000151487 CAAAGTGAAAGAAGTCCTCTT pLKO.1 676 CDS 100% 4.050 2.835 N PPCDC n/a
10 TRCN0000155649 CAACTTGCTTACCTGCGTCAT pLKO.1 460 CDS 100% 4.050 2.835 N PPCDC n/a
11 TRCN0000338681 CAACTTGCTTACCTGCGTCAT pLKO_005 460 CDS 100% 4.050 2.835 N PPCDC n/a
12 TRCN0000154478 GAAAGAAGTCCTCTTCCAGCA pLKO.1 682 CDS 100% 2.160 1.512 N PPCDC n/a
13 TRCN0000338682 GAAAGAAGTCCTCTTCCAGCA pLKO_005 682 CDS 100% 2.160 1.512 N PPCDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021823.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08795 pDONR223 100% 99.6% 99% None 16T>A;234A>G n/a
2 ccsbBroad304_08795 pLX_304 0% 99.6% 99% V5 16T>A;234A>G n/a
3 TRCN0000468747 ATAGACGGAGAAGCAGACGTCGGT pLX_317 74.6% 99.6% 99% V5 16T>A;234A>G n/a
Download CSV