Transcript: Mouse NM_021899.3

Mus musculus forkhead box J2 (Foxj2), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Foxj2 (60611)
Length:
5013
CDS:
802..2499

Additional Resources:

NCBI RefSeq record:
NM_021899.3
NBCI Gene record:
Foxj2 (60611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084288 CCACCCATAATGCTTTGCATT pLKO.1 4875 3UTR 100% 4.950 3.960 N Foxj2 n/a
2 TRCN0000084291 CCTTTCCCTTAACAAGTGTTT pLKO.1 1152 CDS 100% 4.950 3.960 N Foxj2 n/a
3 TRCN0000302139 CCTTTCCCTTAACAAGTGTTT pLKO_005 1152 CDS 100% 4.950 3.960 N Foxj2 n/a
4 TRCN0000084289 GCCACCTTCTAACAACTACTA pLKO.1 1641 CDS 100% 4.950 3.960 N Foxj2 n/a
5 TRCN0000302210 GCCACCTTCTAACAACTACTA pLKO_005 1641 CDS 100% 4.950 3.960 N Foxj2 n/a
6 TRCN0000084290 GCCATCCATGAACCAAGTGAA pLKO.1 2295 CDS 100% 4.950 3.465 N Foxj2 n/a
7 TRCN0000302211 GCCATCCATGAACCAAGTGAA pLKO_005 2295 CDS 100% 4.950 3.465 N Foxj2 n/a
8 TRCN0000084292 CCATGACTTCAAATTCTCCTA pLKO.1 1509 CDS 100% 2.640 1.848 N Foxj2 n/a
9 TRCN0000302137 CCATGACTTCAAATTCTCCTA pLKO_005 1509 CDS 100% 2.640 1.848 N Foxj2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03659 pDONR223 100% 87.6% 90.1% None (many diffs) n/a
2 ccsbBroad304_03659 pLX_304 0% 87.6% 90.1% V5 (many diffs) n/a
3 TRCN0000474644 GGTAGCAAGTGCAGTCAGCTCCGG pLX_317 18.6% 87.6% 90.1% V5 (many diffs) n/a
Download CSV