Transcript: Human NM_021954.4

Homo sapiens gap junction protein alpha 3 (GJA3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GJA3 (2700)
Length:
5214
CDS:
181..1488

Additional Resources:

NCBI RefSeq record:
NM_021954.4
NBCI Gene record:
GJA3 (2700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059780 CCACGGTCATCGGCAAGGTTT pLKO.1 233 CDS 100% 1.650 2.310 N GJA3 n/a
2 TRCN0000422191 ATCAGGTTTCCGTGTTCAATG pLKO_005 1636 3UTR 100% 10.800 8.640 N GJA3 n/a
3 TRCN0000442781 ATCGGGTTCCCACCCTACTAT pLKO_005 976 CDS 100% 5.625 4.500 N GJA3 n/a
4 TRCN0000440603 GGTATCCTGCAGTCCCTTTAG pLKO_005 1824 3UTR 100% 10.800 7.560 N GJA3 n/a
5 TRCN0000059779 GCTCAACATGCTGGAGATCTA pLKO.1 828 CDS 100% 4.950 3.465 N GJA3 n/a
6 TRCN0000426865 GTACTTTCTGTACGGCTTCGA pLKO_005 681 CDS 100% 2.640 1.848 N GJA3 n/a
7 TRCN0000059781 GCTGCGGACCTACGTCTTCAA pLKO.1 615 CDS 100% 1.650 1.155 N GJA3 n/a
8 TRCN0000059778 CGCATGGAAGAGAAGAAGAAA pLKO.1 481 CDS 100% 5.625 3.375 N GJA3 n/a
9 TRCN0000059782 GCTGTTCATCTTCCGCATCTT pLKO.1 264 CDS 100% 4.950 2.970 N GJA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06275 pDONR223 100% 99.8% 99.7% None 895C>A;1017G>A n/a
2 ccsbBroad304_06275 pLX_304 0% 99.8% 99.7% V5 895C>A;1017G>A n/a
3 TRCN0000465255 GTCACGATCCTCAATATGTACTGG pLX_317 24.9% 99.8% 99.7% V5 895C>A;1017G>A n/a
Download CSV