Transcript: Human NM_021958.4

Homo sapiens H2.0 like homeobox (HLX), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
HLX (3142)
Length:
2237
CDS:
416..1882

Additional Resources:

NCBI RefSeq record:
NM_021958.4
NBCI Gene record:
HLX (3142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021958.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014821 CGCATCTCTAGATCCCATTAA pLKO.1 1087 CDS 100% 13.200 18.480 N HLX n/a
2 TRCN0000347985 TCGCATCTCTAGATCCCATTA pLKO_005 1086 CDS 100% 10.800 15.120 N Hlx n/a
3 TRCN0000417658 ACACGCTGAGAGATCTCACTT pLKO_005 996 CDS 100% 4.950 6.930 N HLX n/a
4 TRCN0000014818 GCTTACTGTATGTTGGCGACT pLKO.1 1948 3UTR 100% 2.160 1.728 N HLX n/a
5 TRCN0000014819 GCACCAAACAACAGTTATTAA pLKO.1 1618 CDS 100% 15.000 10.500 N HLX n/a
6 TRCN0000424093 ACACGTTTCCAGGTCCCTATG pLKO_005 1176 CDS 100% 6.000 4.200 N HLX n/a
7 TRCN0000014822 CCAAGAAATTCAGTTCAGCAT pLKO.1 1145 CDS 100% 2.640 1.848 N HLX n/a
8 TRCN0000014820 CCTCCAGCAAAGACCTCAAAT pLKO.1 921 CDS 100% 13.200 7.920 N HLX n/a
9 TRCN0000070706 CCCTCCAGCAAAGACCTCAAA pLKO.1 920 CDS 100% 4.950 2.970 N Hlx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021958.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00749 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00749 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468515 AGTTTGGAGAATACTCCATGGCAC pLX_317 22.5% 100% 100% V5 n/a
Download CSV