Transcript: Mouse NM_022020.2

Mus musculus retinol binding protein 7, cellular (Rbp7), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rbp7 (63954)
Length:
595
CDS:
19..423

Additional Resources:

NCBI RefSeq record:
NM_022020.2
NBCI Gene record:
Rbp7 (63954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105568 CACCTGGAAATGTTCTGCGAA pLKO.1 367 CDS 100% 2.640 2.112 N Rbp7 n/a
2 TRCN0000105566 CCTCAGGAACTACCTTGTAAA pLKO.1 189 CDS 100% 13.200 9.240 N Rbp7 n/a
3 TRCN0000105569 CCTGGGAGAATGACAAACTCA pLKO.1 281 CDS 100% 3.000 2.100 N Rbp7 n/a
4 TRCN0000105567 CCACAGAAAGTGATTGAGCAA pLKO.1 133 CDS 100% 2.640 1.848 N Rbp7 n/a
5 TRCN0000105565 CGCTTGAGGCAACTACTCAAT pLKO.1 445 3UTR 100% 0.495 0.347 N Rbp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04706 pDONR223 100% 87% 89.5% None (many diffs) n/a
2 ccsbBroad304_04706 pLX_304 0% 87% 89.5% V5 (many diffs) n/a
3 TRCN0000473075 ATGAGACTATCCGAGAGTATTGTA pLX_317 87.9% 87% 89.5% V5 (many diffs) n/a
Download CSV