Transcript: Mouse NM_022028.2

Mus musculus salvador family WW domain containing 1 (Sav1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Mus musculus (mouse)
Gene:
Sav1 (64010)
Length:
2524
CDS:
236..1396

Additional Resources:

NCBI RefSeq record:
NM_022028.2
NBCI Gene record:
Sav1 (64010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078882 CTACATCTCTAGGGAATTTAA pLKO.1 792 CDS 100% 15.000 10.500 N Sav1 n/a
2 TRCN0000351937 CTACATCTCTAGGGAATTTAA pLKO_005 792 CDS 100% 15.000 10.500 N Sav1 n/a
3 TRCN0000078880 CGAGTAGAGTCATCAGAATTT pLKO.1 962 CDS 100% 13.200 9.240 N Sav1 n/a
4 TRCN0000351866 CGAGTAGAGTCATCAGAATTT pLKO_005 962 CDS 100% 13.200 9.240 N Sav1 n/a
5 TRCN0000078878 GCAAACAAGTTCTTTGGTTAA pLKO.1 1450 3UTR 100% 10.800 7.560 N Sav1 n/a
6 TRCN0000351938 GCAAACAAGTTCTTTGGTTAA pLKO_005 1450 3UTR 100% 10.800 7.560 N Sav1 n/a
7 TRCN0000078879 CGGCTACATCTCTAGGGAATT pLKO.1 789 CDS 100% 0.000 0.000 N Sav1 n/a
8 TRCN0000078881 GCACAAGAAGATTACAGATAT pLKO.1 692 CDS 100% 13.200 7.920 N Sav1 n/a
9 TRCN0000351865 GCACAAGAAGATTACAGATAT pLKO_005 692 CDS 100% 13.200 7.920 N Sav1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03888 pDONR223 100% 88.6% 93.5% None (many diffs) n/a
2 ccsbBroad304_03888 pLX_304 0% 88.6% 93.5% V5 (many diffs) n/a
3 TRCN0000467208 ACCTCCAGTCGTTTCTAGCTACTG pLX_317 14.1% 88.6% 93.5% V5 (many diffs) n/a
Download CSV