Transcript: Human NM_022047.4

Homo sapiens DEF6 guanine nucleotide exchange factor (DEF6), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DEF6 (50619)
Length:
2296
CDS:
40..1935

Additional Resources:

NCBI RefSeq record:
NM_022047.4
NBCI Gene record:
DEF6 (50619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022047.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053586 AGAAGAACTATCGGGCAGATA pLKO.1 338 CDS 100% 4.950 3.465 N DEF6 n/a
2 TRCN0000053584 CTCTGCTACTTTGGGAGTGAA pLKO.1 772 CDS 100% 4.950 3.465 N DEF6 n/a
3 TRCN0000053583 GAGGTGGAATACCTGCTGAAA pLKO.1 460 CDS 100% 4.950 3.465 N DEF6 n/a
4 TRCN0000100166 GCCCTACCTCAACAAGTACAT pLKO.1 246 CDS 100% 4.950 3.465 N Def6 n/a
5 TRCN0000053587 CAACAGCAATGAGCAGCAGAA pLKO.1 1833 CDS 100% 4.050 2.835 N DEF6 n/a
6 TRCN0000053585 GAGATGAAGAATCTGTGCGAA pLKO.1 1388 CDS 100% 2.640 1.848 N DEF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022047.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11924 pDONR223 100% 53.1% 53% None 860A>C;1009_1893del n/a
2 ccsbBroad304_11924 pLX_304 0% 53.1% 53% V5 860A>C;1009_1893del n/a
Download CSV