Transcript: Human NM_022104.4

Homo sapiens PDX1 C-terminal inhibiting factor 1 (PCIF1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PCIF1 (63935)
Length:
2689
CDS:
310..2424

Additional Resources:

NCBI RefSeq record:
NM_022104.4
NBCI Gene record:
PCIF1 (63935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022104.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276215 CGTGGTCTGCATCCGGTATAA pLKO_005 1587 CDS 100% 13.200 18.480 N PCIF1 n/a
2 TRCN0000157332 CGATGTGATTTCGGACCCTTT pLKO.1 549 CDS 100% 4.050 5.670 N PCIF1 n/a
3 TRCN0000156935 GTCCCTACTACTTCAACCGAT pLKO.1 485 CDS 100% 2.640 3.696 N PCIF1 n/a
4 TRCN0000276251 ACGACATTCCTATCAGGTTAT pLKO_005 1115 CDS 100% 10.800 7.560 N PCIF1 n/a
5 TRCN0000158063 CATCCAGACCAATGCTGTCAT pLKO.1 846 CDS 100% 4.950 3.465 N PCIF1 n/a
6 TRCN0000285500 CATCCAGACCAATGCTGTCAT pLKO_005 846 CDS 100% 4.950 3.465 N PCIF1 n/a
7 TRCN0000156618 GATGCCATGGTCTCTCACTTT pLKO.1 1993 CDS 100% 4.950 3.465 N PCIF1 n/a
8 TRCN0000156865 GCAAGGTGGTAGACAAAGGAT pLKO.1 1028 CDS 100% 3.000 2.100 N PCIF1 n/a
9 TRCN0000285499 GCAAGGTGGTAGACAAAGGAT pLKO_005 1028 CDS 100% 3.000 2.100 N PCIF1 n/a
10 TRCN0000276216 ATATGAAGATTATGGTTCTGC pLKO_005 2520 3UTR 100% 2.640 1.848 N PCIF1 n/a
11 TRCN0000154448 GTGGTCAAATGGAATGTGGAA pLKO.1 1240 CDS 100% 2.640 1.848 N PCIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022104.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.