Transcript: Human NM_022121.5

Homo sapiens p53 apoptosis effector related to PMP22 (PERP), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PERP (64065)
Length:
4198
CDS:
80..661

Additional Resources:

NCBI RefSeq record:
NM_022121.5
NBCI Gene record:
PERP (64065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022121.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123327 CCTGCTGTCACTTACATCTAT pLKO.1 506 CDS 100% 5.625 3.938 N PERP n/a
2 TRCN0000289527 CCTGCTGTCACTTACATCTAT pLKO_005 506 CDS 100% 5.625 3.938 N PERP n/a
3 TRCN0000123328 GCAGCCACGATTATCCTGATT pLKO.1 551 CDS 100% 4.950 3.465 N PERP n/a
4 TRCN0000123325 CGTGAAGTACACCCAGACCTT pLKO.1 469 CDS 100% 2.640 1.848 N PERP n/a
5 TRCN0000289583 CGTGAAGTACACCCAGACCTT pLKO_005 469 CDS 100% 2.640 1.848 N PERP n/a
6 TRCN0000123324 GCTTTCCTTTAAGTGTGAAAT pLKO.1 1310 3UTR 100% 13.200 7.920 N PERP n/a
7 TRCN0000289584 GCTTTCCTTTAAGTGTGAAAT pLKO_005 1310 3UTR 100% 13.200 7.920 N PERP n/a
8 TRCN0000123326 CCAGATCATCTCCCTGGTAAT pLKO.1 442 CDS 100% 10.800 5.400 Y PERP n/a
9 TRCN0000289582 CCAGATCATCTCCCTGGTAAT pLKO_005 442 CDS 100% 10.800 5.400 Y PERP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022121.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.