Transcript: Human NM_022130.4

Homo sapiens golgi phosphoprotein 3 (GOLPH3), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GOLPH3 (64083)
Length:
2678
CDS:
286..1182

Additional Resources:

NCBI RefSeq record:
NM_022130.4
NBCI Gene record:
GOLPH3 (64083)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022130.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111621 CGTGGCTGTATGTTAATTGAA pLKO.1 553 CDS 100% 5.625 7.875 N Golph3 n/a
2 TRCN0000309862 CGTGGCTGTATGTTAATTGAA pLKO_005 553 CDS 100% 5.625 7.875 N Golph3 n/a
3 TRCN0000146377 CGTTCTTGACAAATGGGTGAA pLKO.1 945 CDS 100% 4.050 5.670 N GOLPH3 n/a
4 TRCN0000150069 CAGTTAAGAAATGTACGGGAA pLKO.1 790 CDS 100% 2.160 3.024 N GOLPH3 n/a
5 TRCN0000319292 CAGTTAAGAAATGTACGGGAA pLKO_005 790 CDS 100% 2.160 3.024 N GOLPH3 n/a
6 TRCN0000150176 GCTTGCTTCAATCATGGTTAT pLKO.1 1936 3UTR 100% 10.800 7.560 N GOLPH3 n/a
7 TRCN0000319365 GCTTGCTTCAATCATGGTTAT pLKO_005 1936 3UTR 100% 10.800 7.560 N GOLPH3 n/a
8 TRCN0000149772 GCTTGTGGAATGAGACGTAAA pLKO.1 604 CDS 100% 10.800 7.560 N GOLPH3 n/a
9 TRCN0000319362 GCTTGTGGAATGAGACGTAAA pLKO_005 604 CDS 100% 10.800 7.560 N GOLPH3 n/a
10 TRCN0000147628 GAGAAACAGAACTTCCTACTT pLKO.1 853 CDS 100% 4.950 3.465 N GOLPH3 n/a
11 TRCN0000319293 GAGAAACAGAACTTCCTACTT pLKO_005 853 CDS 100% 4.950 3.465 N GOLPH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022130.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03918 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03918 pLX_304 0% 100% 100% V5 n/a
Download CSV