Transcript: Human NM_022142.5

Homo sapiens epididymal sperm binding protein 1 (ELSPBP1), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
ELSPBP1 (64100)
Length:
1079
CDS:
198..869

Additional Resources:

NCBI RefSeq record:
NM_022142.5
NBCI Gene record:
ELSPBP1 (64100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022142.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372126 CACCTACAAGGGATCTGTTTA pLKO_005 296 CDS 100% 13.200 18.480 N ELSPBP1 n/a
2 TRCN0000372067 TATCGAGGAAAGGCTTATAAC pLKO_005 435 CDS 100% 13.200 18.480 N ELSPBP1 n/a
3 TRCN0000372068 GAAGATTACCCACGCTGTATC pLKO_005 402 CDS 100% 10.800 15.120 N ELSPBP1 n/a
4 TRCN0000168569 GAACATGGATAAGGATGGAAA pLKO.1 668 CDS 100% 4.950 3.465 N ELSPBP1 n/a
5 TRCN0000168756 GTGTGCAACTTCTTACAACTA pLKO.1 818 CDS 100% 4.950 3.465 N ELSPBP1 n/a
6 TRCN0000172782 GCTTTCCTTGTCACTTTCCGT pLKO.1 733 CDS 100% 0.750 0.525 N ELSPBP1 n/a
7 TRCN0000168657 GCACCCATATTCATAGCTTAT pLKO.1 325 CDS 100% 10.800 5.400 Y ELSPBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022142.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08833 pDONR223 100% 99.8% 99.5% None 595G>A n/a
2 ccsbBroad304_08833 pLX_304 0% 99.8% 99.5% V5 595G>A n/a
3 TRCN0000473964 ATCCGCTTGTGACCGATTAGACGA pLX_317 77.3% 99.8% 99.5% V5 595G>A n/a
Download CSV