Transcript: Human NM_022365.4

Homo sapiens DnaJ heat shock protein family (Hsp40) member C1 (DNAJC1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DNAJC1 (64215)
Length:
2100
CDS:
297..1961

Additional Resources:

NCBI RefSeq record:
NM_022365.4
NBCI Gene record:
DNAJC1 (64215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022365.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022306 AGGTACAAGTTGCTGGTTGAA pLKO.1 1908 CDS 100% 4.950 6.930 N DNAJC1 n/a
2 TRCN0000280272 AGATGATGTTCACCTTCATTT pLKO_005 1972 3UTR 100% 13.200 9.240 N DNAJC1 n/a
3 TRCN0000273751 ACTGACAAGAAGTATGGTTAA pLKO_005 1307 CDS 100% 10.800 7.560 N Dnajc1 n/a
4 TRCN0000022305 GCAGCAAGAGTGTGGATGTAT pLKO.1 880 CDS 100% 5.625 3.938 N DNAJC1 n/a
5 TRCN0000297811 GCAGCAAGAGTGTGGATGTAT pLKO_005 880 CDS 100% 5.625 3.938 N DNAJC1 n/a
6 TRCN0000022308 GCATATCGTAAGCTTTCACTA pLKO.1 546 CDS 100% 4.950 3.465 N DNAJC1 n/a
7 TRCN0000280286 GCATATCGTAAGCTTTCACTA pLKO_005 546 CDS 100% 4.950 3.465 N DNAJC1 n/a
8 TRCN0000022304 GCTGGCATTACTCTTGTTCAT pLKO.1 755 CDS 100% 4.950 3.465 N DNAJC1 n/a
9 TRCN0000022307 GCAGCTCAACTTCTACCAGTT pLKO.1 482 CDS 100% 4.050 2.835 N DNAJC1 n/a
10 TRCN0000280333 GCAGCTCAACTTCTACCAGTT pLKO_005 482 CDS 100% 4.050 2.835 N DNAJC1 n/a
11 TRCN0000008540 CCAGACAAGAATAAAGATGAA pLKO.1 576 CDS 100% 4.950 2.970 N Dnajc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022365.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12460 pDONR223 100% 61.3% 61.1% None 1_642del;1555C>T n/a
2 ccsbBroad304_12460 pLX_304 0% 61.3% 61.1% V5 1_642del;1555C>T n/a
3 TRCN0000465875 TCTCCACTCTCTTGAGCCTGCTCG pLX_317 14.7% 61.3% 61.1% V5 1_642del;1555C>T n/a
Download CSV