Transcript: Human NM_022453.3

Homo sapiens ring finger protein 25 (RNF25), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
RNF25 (64320)
Length:
1477
CDS:
33..1412

Additional Resources:

NCBI RefSeq record:
NM_022453.3
NBCI Gene record:
RNF25 (64320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022453.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004601 GATGAACTACAGGTGATTAAA pLKO.1 117 CDS 100% 15.000 10.500 N RNF25 n/a
2 TRCN0000433686 TCCCTCTGAAGTTGAAGTATT pLKO_005 80 CDS 100% 13.200 9.240 N RNF25 n/a
3 TRCN0000419831 CACAGATCTCTATCCGAAATC pLKO_005 268 CDS 100% 10.800 7.560 N RNF25 n/a
4 TRCN0000415186 CCATGCTGTATGAACTCATTG pLKO_005 367 CDS 100% 10.800 7.560 N RNF25 n/a
5 TRCN0000004602 TGGGAGGGAGGCAATAAAGAT pLKO.1 1446 3UTR 100% 5.625 3.938 N RNF25 n/a
6 TRCN0000004600 GAGGACCAGGATTCACAGTAT pLKO.1 195 CDS 100% 4.950 3.465 N RNF25 n/a
7 TRCN0000429817 GTTCGCTGGGAGCGCTCTAAA pLKO_005 1284 CDS 100% 4.400 3.080 N RNF25 n/a
8 TRCN0000004604 CAGGTCAAATCAGCAAAGGTT pLKO.1 998 CDS 100% 3.000 2.100 N RNF25 n/a
9 TRCN0000004603 GAAACCCAGAAAGCTATGCTA pLKO.1 1023 CDS 100% 3.000 2.100 N RNF25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022453.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03939 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03939 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478743 TGGTTTTACCCAATGTGTAAACCG pLX_317 25.9% 100% 100% V5 n/a
Download CSV